To be of better service to you this website makes use of cookies More info

Brassica Information Portal

Brassica Information Portal API

General introduction

BIP provides a HTTP RESTful API which uses JSON to represent resources. Resources represent database model elements (tables) which constitute BIP Schema. Full access to the API is allowed for all registered users. In order to authenticate your request, pass the X-BIP-Api-Key header in each call to the API.

You need to sign in to obtain your personal API key.

The API exposes several resources for which fetching and submission of new entries is supported [1]. These include:

  • LinkageGroup
  • LinkageMap
  • MapLocusHit
  • MapPosition
  • MarkerAssay
  • PlantAccession
  • PlantLine
  • PlantPopulation
  • PlantPopulationList
  • PlantScoringUnit
  • PlantTrial
  • PlantVariety
  • TraitDescriptor
  • TraitScore
  • DesignFactor
  • PopulationLocus
  • Primer
  • Probe
  • Qtl
  • QtlJob

All attributes are expressed as basic data types such as int, string, date or arrays of these. Most of the related objects are not directly included in the response - instead they are represented by identifiers (or arrays of identifiers); for instance taxonomy_term_id or qtl_ids. Use these identifiers to retrieve the relevant resources with further API calls.

Those related objects which are not available through a dedicated API read call are always embedded in the parent data structure - for example, population_type. They are usually represented by the object format in the attribute tables.

Example

HTTP/1.1 200 OK
Content-Type: application/json; charset=utf-8

{
  "plant_population": {
    "id": 1,
    "name": "BnaWAIT_01",
    "population_type": {
      "population_type": "Integrated",
      "population_class": "Mapping",
      ...
    },
    ...
    "linkage_map_ids": [8]
  }
}

Several resources support fetching data only:

  • Country
  • PlantPart
  • PopulationType
  • TaxonomyTerm
  • Trait

Fetching data

Any resource can be fetched by passing its id. Multiple resources can be fetched with or without additional parameters to filter results. These parameters are specific for each resource and will be described in detail later on.

If a resource is owned by another BIP user, and is set as not published, you will not be able to fetch it.

Fetching multiple resources always yields paginated results.

Pagination parameters
page int Page number (default: 1)
per_page int Page size (default: 50, max: 200)
Paginated response metadata
meta[page] int Current page number
meta[per_page] int Page size
meta[total_count] int Total number of existing records

Example

GET /api/v1/plant_lines?page=2&per_page=100 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
HTTP/1.1 200 OK
Content-Type: application/json

{
  "plant_lines": [
    {
      "id": 6,
      ...
    },
    ...
  ],
  "meta": {
    "page": 2,
    "per_page": 100,
    "total_count": 1291
  }
}

Remember to replace X-BIP-Api-Key with your own API key.

Filtering data

Most resources can be filtered by selected attributes. The attribute tables (listed below for each resource type) indicate when a specific attribute may be subject to filtering - look for the `Q` marker. The usage pattern is as follows:

Query filtering
resource_name[query][attribute_name] depends on the attribute format Should return only those resources which declare a certain value for attribute_name.

Examples

  1. Plant Line filtering by plant_line_name

    GET /api/v1/plant_lines?plant_line[query][plant_line_name]=WINFRED HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
    Sign in to try it in your browser!

  2. Multiple filtering attributes can be applied in a single query - here we filter Plant Varieties by owner and registration_year 

    GET /api/v1/plant_varieties?plant_variety[query][owner]=Limagrain&plant_variety[query][reqistration_year]=1998 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
    Sign in to try it in your browser!

One additional special filter, called only_mine may be used to fetch only the resources which you own (that is, which were created by you). This is how you use this special filter: 

GET /api/v1/plant_varieties?only_mine=true HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!

Searching for data

It is also possible to search for a given resource by passing a term and matching it against multiple attributes at once. This resembles the search capability available on the BIP front page. Such queries need to be scoped by resource type.

What exactly is being sought? The resource attributes that are checked for the presence of the search term are basically all those marked with the `Q` tag in the attribute tables. Additionally, some related resource attributes are checked - the rule of thumb is that if an attribute value is visible as a column in the browse data tables, it should be searchable via the fetch API parameter.

Searching
resource_name[fetch] string Given a term, it should return all resources of a given type whose attribute values match (at least partially) the search term.

Examples

  1. Plant Lines search

    GET /api/v1/plant_lines?plant_line[fetch]=WINFRED HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
    Sign in to try it in your browser!

  2. The result includes metadata showing how many records were found - see the total_count value in the meta result document element. It is therefore possible to combine filtering and pagination in a single request, e.g. to retrieve further data. 

    GET /api/v1/plant_lines?plant_line[fetch]=WINFRED&per_page=2&page=2 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
    Sign in to try it in your browser!

  3. Searching by related object attribute - the name of a Taxonomy Term 

    GET /api/v1/plant_populations?plant_population[fetch]=oleracea&per_page=5 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
    Sign in to try it in your browser!

In order to maintain consistency between successive searches, all search results are ordered by their internal id BIP identifier. This ensures the API will return the same results in the same order in two subsequent calls - provided, of course, no new data is submitted in the meantime. For this reason the results of `fetch` API calls might differ slightly from what can be obtained via the web search form.

Traversing data model

Each record returned by described methods includes its BIP internal numerical identifier, id. Also, a list of related records is usually provided as an array of such numbers, for instance a Plant Scoring Unit may have multiple related Trait Scores: 

{
  "plant_scoring_units": [
    {
      "id": :84208,
      "trait_score_ids": [98413,98412],
      ...
    }
  ]
}

Using these identifiers it is possible to query BIP for these related records: 

GET /api/v1/trait_scores?trait_score[query][id]=98413 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!

Please note the plant_scoring_unit_id field in the returned JSON response. Due to the symmetry of relations, this should refer back to the original Plant Scoring Unit record (id 84208).

Submitting new data

The following resources can currently be submitted via API calls:

  • LinkageGroup
  • LinkageMap
  • MapLocusHit
  • MapPosition
  • MarkerAssay
  • PlantAccession
  • PlantLine
  • PlantPopulation
  • PlantPopulationList
  • PlantScoringUnit
  • PlantTrial
  • PlantVariety
  • TraitDescriptor
  • TraitScore
  • DesignFactor
  • PopulationLocus
  • Primer
  • Probe
  • Qtl
  • QtlJob

Data submission is based on the JSON format, i.e., the API POST request should pass a JSON document whose root element matches the name of the target resource type (e.g. plant_population). Each resource section below shows an example of such a POST API call.

For each resource some attributes (described later) are required in create requests. Skipping any of those will result in a 422 error response. Passing attributes which are not recognized by the API will also produce 422 errors.

Examples

  1. Missing value for required attribute

    HTTP/1.1 422 Unprocessable Entity
Content-Type: application/json

{
  "errors": [
    { "attribute": "name", "message": "Can't be blank" }
  ]
}

  2. Misspelled attribute name

    HTTP/1.1 422 Unprocessable Entity
Content-Type: application/json

{
  "errors": [
    { "attribute": "priner", "message": "Unrecognized attribute name" }
  ]
}

Most of the resource attributes, as shown in the following attribute tables, are textual (string format) - these are simply pieces of text of arbitrary length, enclosed in double quotation marks ". Attributes that are of int format are passed without quotes.

Dates should be entered in a textual format - several different notations are recognized and accepted, although we suggest sticking to a single, consistent format - YYYY-MM-DD. Examples are provided below:

Example

{
  "plant_population": {
    ...
    "description": "Example of text content",
    "date_established": "2015-05-30",
    "taxonomy_term_id": 5,
    ...
  }
}

Two attributes are never entered by users, but are instead automatically set by the server:

Default attribute values
entered_by_whom string Always set to the name of the user whose API Key was used to submit the data.
date_entered date Always set to the day the data was successfully submitted.

Finally, attributes marked as readonly in the attribute tables cannot be directly set. These include single related resources (one such example is the population_type of a Plant Population). In this case, one should provide the BIP identifier of a related object when submitting new data. For instance, when submitting a new Plant Population:

Example

{
  "plant_population": {
    ...
    "population_type": "DH segregating",  # WRONG
    "population_type_id": 1,  # RIGHT
    ...
  }
}

If the provided identifier does not exist in the BIP database, the following error will be returned: 

HTTP/1.1 422 Unprocessable Entity
Content-Type: application/json

{
  "errors": [
    {
      "attribute": "plant_population_id",
      "message": "DETAIL:  Key (plant_population_id)=(1000000) is not present in table \"plant_populations\"."
    }
  ]
}

Another case of a readonly attribute involves multiple related resources - for instance, plant_trials_ids of a Plant Population. In such cases the correct relationship is set while submitting the corresponding resource (i.e., in a reverse fashion). For example, when submitting a new Plant Trial, supplying a correct value of plant_population_id will create the intended relationship.

If the submission is successful, you will get a JSON document in return. Since the document describes the submitted record, it will mostly contain the data you have just submitted. However, it also provides the internal BIP identifier assigned to the new record - see the value of the id attribute. 

HTTP/1.1 201 Created
Content-Type: application/json

{
  "plant_line": {
    "plant_line_name": "Plant line by API",
    ...
    "entered_by_whom": "Your User Name",
    "date_entered": "2015-07-18"
    "id": 25697
  }
}

You may now utilize that identifier to relate your newly created object with other records you are about to submit (for instance, new Plant Populations).

Publishing submitted data

The basic data management policy of BIP is that after you submit your data it becomes public and can be cited as a public resource by other users. However, you can explicitly state that you wish your data to remain private.

Example

POST /api/v1/trait_scores HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "trait_score": {
    "published": false,
    ...
  }
}

Data submitted as private can be published at a later date. Resources which are to be published need to be updated one by one.

Example

PATCH /api/v1/trait_scores/:id/publish HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

The rule of thumb is that after publishing data you have exactly one week to revoke publication. Please use this time to check whether all information was correctly provided. After one week, the publication becomes permanent and cannot be revoked.

Example

PATCH /api/v1/trait_scores/:id/revoke HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

This operation will not delete your data, but BIP will no longer show it to other users. You can publish it again whenever you wish.

Deleting submitted data

Mistakes do happen and therefore we provide the ability to delete submitted resources. You can only delete private resources or published resources for which the revocation timer has not yet expired. Should you wish to delete any other data, please contact the BIP support team directly.

Example

DELETE /api/v1/plant_populations/5555 HTTP/1.1
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

This example shows how to delete the Plant Population with the internal BIP id equal 5555. This may result in several different responses:

Examples

  1. Wrong, nonexistent Plant Population

    HTTP/1.1 404 Not Found
Content-Type: application/json

{
  "reason": "Resource not found"
}

  2. API key owner and resource owner are not the same user

    HTTP/1.1 401 Unauthorized
Content-Type: application/json

{
  "reason": "API key owner and resource owner mismatch"
}

  3. The requested resource is already past its revocation period and cannot be deleted anymore

    HTTP/1.1 403 Forbidden
Content-Type: application/json

{
  "reason": "This resource is already published and irrevocable"
}

  4. The call was a success, the resource was deleted

    HTTP/1.1 204 No Content

API client example

In order to demonstrate the capabilities of the API and to assist new programmers in preparing their own BIP client code, we provide a fairly complex example of a client program, written in Ruby (Ruby MRI interpreter version 2.2 is required to run it).

The sample client consists of two elements:

You will also need your API key. Please refer to the general introduction for instructions on how to obtain it. Additional information regarding the example is contained in the script file - the code is rather self-explanatory, and we provide embedded comments.

It should be noted that this script is not meant to be a generic, all-purpose client for the BIP API. Rather, its purpose is to provide an example of how to prepare your own scripts, matching specific user requirements. The sample data was generated on the basis of RIPR project data, with altered (fictional) values.

Detailed model introduction

Below, the resources (which mostly represent data base tables in the BIP data model) and their attributes (which correspond, to large extent, with individual columns in data base tables) that are exposed with the API are described in more detail. Use these attributes in your calls to the API. For each resource, a set of examples for various API calls is given below its attributes table.

Country

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
country_code string Q ISO 3166-1 alpha-3 code of this Country
country_name string Q Name of this Country in English
plant_trial_ids int[] Zero or more BIP identifiers of Plant Trials which took place in this Country
originating_plant_variety_ids int[] Zero or more BIP identifiers of Plant Varieties originating in this Country
registered_plant_variety_ids int[] Zero or more BIP identifiers of Plant Varieties registered in this Country
GET /api/v1/countries

Example

GET /api/v1/countries?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/countries/:id

Example

GET /api/v1/countries/2 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!

DesignFactor

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
design_factor_name string An optional name assigned to this design factor
institute_id string Name of the institute in case which designed the experiment
trial_location_name string Optional name of the location where this design was used
design_unit_counter string required The ordinal number of a unique design factor for a given plant trial; it is safe to set it to the number of the smallest design factors (e.g. "354")
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_owned_by string Name of the legal entity which published this data
data_provenance string Additional information regarding the origin of this data
confirmed_by_whom string The person who accepted this BIP database entry
design_factors string[] required List of values for subsequent design factors, which go from the biggest factor to the smallest one, structures as factor_number (e.g. "block_2", "row_V", "plot_354")
plant_scoring_unit_ids int[] readonly Zero or more BIP identifiers of Plant Scoring Units which have this Design Factor in a Plant Trial
GET /api/v1/design_factors

Example

GET /api/v1/design_factors?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/design_factors/:id

Example

GET /api/v1/design_factors/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/design_factors

Example

POST /api/v1/design_factors HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "design_factor": {
    "design_factor_name": "New design of our institute",
    "design_factors": ["block_2", "row_V", "plot_354"],
    "design_unit_counter": "354"
  }
}

LinkageGroup

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
linkage_group_label string required, Q The label given to this linkage group by the database curator
linkage_group_name string required, Q Unique name of this linkage group
total_length string Q Total length of this linkage group in centimorgan (cM)
lod_threshold string Q The threshold of LOD score of similarity for this linkage group
consensus_group_assignment string required, Q Consensus group identification (e.g. A01, C09) in accordance with community naming standards
consensus_group_orientation string Q Consensus orientation of the linkage group on the target chromosome
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_owned_by string Name of the legal entity which published this data
data_provenance string Additional information regarding the origin of this data
confirmed_by_whom string The person who accepted this BIP database entry
linkage_map_id int BIP identifier of the Linkage Maps this group belongs to
map_position_ids int[] readonly Zero or more BIP identifiers of Map Positions related to this group
map_locus_hit_ids int[] readonly Zero or more BIP identifiers of Map Locus Hits related to this group
qtl_ids int[] readonly Zero or more BIP identifiers of Quantitative Trait Loci related to this group
published_on datetime readonly The day and time the data was published
GET /api/v1/linkage_groups

Example

GET /api/v1/linkage_groups?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/linkage_groups/:id

Example

GET /api/v1/linkage_groups/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/linkage_groups

Example

POST /api/v1/linkage_groups HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "linkage_group": {
    "linkage_group_label": "2015_group1",
    "linkage_group_name": "NG2",
    "consensus_group_assignment": "C02"
  }
}

LinkageMap

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
linkage_map_label string required, Q Label assigned to this linkage map by the database curator
linkage_map_name string required, Q Unique name of this linkage map
map_version_no string required, Q Descriptive number of this linkage map's version
map_version_date date Q Date on which this linkage map was prepared
mapping_software string Description of the software package used to create this linkage map
mapping_function string Description of the algorithm used to create this linkage map
map_author string Person who created this linkage map
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_owned_by string Name of the legal entity which published this data
data_provenance string Additional information regarding the origin of this data
confirmed_by_whom string The person who accepted this BIP database entry
pubmed_id string PubMed identifier of the publication where this linkage map was published
plant_population_id int BIP identifier of the Plant Population for which this linkage map was created
linkage_group_ids int[] readonly Zero or more BIP identifiers of Linkage Groups belonging to this map
map_locus_hit_ids int[] readonly Zero or more BIP identifiers of Map Locus Hits related to this map
qtl_job_ids int[] readonly Zero or more BIP identifiers of Qtl Jobs that computed elements of this map
published_on datetime readonly The day and time the data was published
GET /api/v1/linkage_maps

Example

GET /api/v1/linkage_maps?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/linkage_maps/:id

Example

GET /api/v1/linkage_maps/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/linkage_maps

Example

POST /api/v1/linkage_maps HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "linkage_map": {
    "linkage_map_label": "2015_group1",
    "linkage_map_name": "B rapa map 2015",
    "map_version_no": "2"
  }
}

MapLocusHit

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
consensus_group_assignment string required, Q Consensus group identification (e.g. A01, C09) in accordance with community naming standards
canonical_marker_name string required, Q Marker assay related to this map locus hit
associated_sequence_id string required, Q Identifier of the nucleotide sequence related to this hit in external database
sequence_source_acronym string required, Q Name of the external database where to look for the associated nucleotide sequence
atg_hit_seq_id string Q Associated identifier in the e!ensembl portal
atg_hit_seq_source string Q Indication about the source of the sequence (usually the e!ensembl portal)
bac_hit_seq_id string Q Identification of sequence obtained with bacterial artificial chromosome (BAC) method
bac_hit_seq_source string Q Indication about the source of the BAC sequence (usually NCBI services)
bac_hit_name string Q Brassica BAC clone identifier as used in the linked external database
linkage_map_id int BIP identifier of the Linkage Map related to this locus hit
linkage_group_id int BIP identifier of the Linkage Group related to this locus hit
population_locus_id int BIP identifier of the Population Locus related to this locus hit
map_position_id int BIP identifier of the Map Position of this locus hit
published_on datetime readonly The day and time the data was published
GET /api/v1/map_locus_hits

Example

GET /api/v1/map_locus_hits?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/map_locus_hits/:id

Example

GET /api/v1/map_locus_hits/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/map_locus_hits

Example

POST /api/v1/map_locus_hits HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "map_locus_hit": {
    "consensus_group_assignment": "C02",
    "canonical_marker_name": "PW177",
    "associated_sequence_id": "1",
    "sequence_source_acronym": "NCBI_GSS"
  }
}

MapPosition

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
map_position string required, Q Position identifier
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_owned_by string Name of the legal entity which published this data
data_provenance string Additional information regarding the origin of this data
confirmed_by_whom string The person who accepted this BIP database entry
marker_assay_id int BIP identifier of the associated Marker Assay
linkage_group_id int BIP identifier of the Linkage Group this map position is listed in
population_locus_id int BIP identifier of the Population Locus for this map position
map_locus_hit_ids int[] readonly Zero or more BIP identifiers of Map Locus Hits related to this position
published_on datetime readonly The day and time the data was published
GET /api/v1/map_positions

Example

GET /api/v1/map_positions?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/map_positions/:id

Example

GET /api/v1/map_positions/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/map_positions

Example

POST /api/v1/map_positions HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "map_position": {
    "map_position": "102.5"
  }
}

MarkerAssay

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
marker_assay_name string required, Q Unique name assigned to this marker assay by the data contributor or database curator
canonical_marker_name string required, Q Canonical name for this assay as assigned by the database curator
marker_type string Q The type of marker represented by this data
separation_system string Q Separation system applied in this marker assay
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_owned_by string Name of the legal entity which published this data
data_provenance string Additional information regarding the origin of this data
confirmed_by_whom string The person who accepted this BIP database entry
probe_id int BIP identifier of the associated Probe
primer_a_id int BIP identifier of the Primer associated with this marker assay (5` end)
primer_b_id int BIP identifier of the Primer associated with this marker assay (3` end)
population_locus_ids int[] readonly Zero or more BIP identifiers of Population Locus related to this marker assay
map_position_ids int[] readonly Zero or more BIP identifiers of Map Positions related to this marker assay
published_on datetime readonly The day and time the data was published
GET /api/v1/marker_assays

Example

GET /api/v1/marker_assays?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/marker_assays/:id

Example

GET /api/v1/marker_assays/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/marker_assays

Example

POST /api/v1/marker_assays HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "marker_assay": {
    "marker_assay_name": "My marker assay name",
    "canonical_marker_name": "Mma"
  }
}

PlantAccession

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
plant_accession string required, Q Unique name given to this accession
plant_accession_derivation string Q What is the source of plant accession information (for instance, an experiment)
accession_originator string Q Person who maintains this accession
originating_organisation string required, Q Name of the legal entity that maintains this accession
year_produced string Q Year the plant was produced in
date_harvested date Q Day the plant was harvested on
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_owned_by string Name of the legal entity which published this data
data_provenance string Additional information regarding the origin of this data
confirmed_by_whom string The person who accepted this BIP database entry
plant_line_id int required (if no plant_variety_id) BIP identifier of the associated Plant Line
plant_variety_id int required (if no plant_line_id) BIP identifier of the associated Plant Variety
plant_scoring_unit_ids int[] readonly Zero or more BIP identifiers of Plant Scoring Units performed for this plant
published_on datetime readonly The day and time the data was published
NOTE: you should link a new Plant Accession to either a Plant Line of a Plant Variety. So, excatly one of plant_line_id and plant_variety_id attributes should be provided (but never both). Also note that the combination of (plant_accession, originating_organisation and year_produced must uniquely identify the accession, i.e. no two records with identical values in all three fields may exist in the database.
GET /api/v1/plant_accessions

Example

GET /api/v1/plant_accessions?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/plant_accessions/:id

Example

GET /api/v1/plant_accessions/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/plant_accessions

Example

POST /api/v1/plant_accessions HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "plant_accession": {
    "plant_accession": "Accession1",
    "originating_organisation": "EI",
    "plant_line_id": 15523
  }
}

PlantLine

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
plant_line_name string required, Q Unique name of this Plant Line provided by the person who submitted the data
common_name string Q Common name of this Plant Line that is widely recognized by the breeder community
named_by_whom string Individual or legal entity which gave the line its name
organisation string Q Legal entity which owns this Plant Line
genetic_status string Q Design method used to obtain this population line (i.e. open pollinated, inbred, substitution lines)
sequence_identifier string Q Identifier of the line sequence, in an external database, like NCBI SRA. Identifiers starting with SR will be automatically recognized as SRA submissions.
previous_line_name string Q Old name of the Plant Line, if changed
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_provenance string Additional information regarding the origin of this data
data_owned_by string Name of the legal entity which published this data
confirmed_by_whom string The person who accepted this BIP database entry
taxonomy_term_id int BIP identifier of a Taxonomy Term entry related to this record
plant_variety_id int BIP identifier of the Plant Variety which this Plant Line is classified as
plant_variety_name string readonly Legacy Plant Variety name (pending curation)
fathered_descendant_ids int[] readonly Zero or more BIP identifiers of Plant Populations descending from this entry in the male line
mothered_descendant_ids int[] readonly Zero or more BIP identifiers of Plant Populations descending from this entry in the female line
plant_accession_ids int[] readonly Zero or more BIP identifiers of related Plant Accessions
plant_population_ids int[] readonly Zero or more BIP identifiers of Plant Populations bred in this Plant Line
plant_population_list_ids int[] readonly Zero or more BIP identifiers of Plant Population Lists, which serve as a join table between Plant Lines and Plant Populations
published_on datetime readonly The day and time the data was published
GET /api/v1/plant_lines

Example

GET /api/v1/plant_lines?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/plant_lines/:id

Example

GET /api/v1/plant_lines/9189 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/plant_lines

Example

POST /api/v1/plant_lines HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "plant_line": {
    "plant_line_name": "My new line"
  }
}

PlantPart

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
plant_part string Name of the part of a plant
description string Longer text explaining what part of plant this record represents
label string Plant Ontology identifier, if available
canonical boolean Set to true if the term is defined in Plant Ontology; false otherwise
described_by_whom string The person or organization who described this dictionary entry
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_provenance string Additional information regarding the origin of this data
confirmed_by_whom string The person who accepted this BIP database entry
trait_descriptor_ids int[] Zero or more BIP identifiers of Trait Descriptors that describe traits scored using this Plant Part
GET /api/v1/plant_parts

Example

GET /api/v1/plant_parts?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/plant_parts/:id

Example

GET /api/v1/plant_parts/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!

PlantPopulation

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
name string required, Q Unique name of this Plant Population provided when submitting data
data_owned_by string Name of the legal entity which published this data
population_type object readonly Additional information about the type of this population
description string Q Textual description of the population,provided by the data publisher
date_established date Year of population introduction
established_by_whom string The person, if known, who introduced this population
establishing_organisation string required, Q Legal entity that introduced this population
population_owned_by string Name of the legal entity which owns this population
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_owned_by string Name of the legal entity which published this data
data_provenance string Additional information regarding the origin of this data
confirmed_by_whom string The person who accepted this BIP database entry
taxonomy_term_id int BIP identifier of a Taxonomy Term entry related to this record
population_type_id int BIP identifier of the Population Type assigned to this population
male_parent_line_id int BIP identifier of the Plant Line which this population descends from in the male line
female_parent_line_id int BIP identifier of the Plant Line which this population descends from in the female line
linkage_map_ids int[] readonly Zero or more BIP identifiers of Linkage Maps defined for this population
population_locus_ids int[] readonly Zero or more BIP identifiers of Population Loci published for this population up until the present date
plant_trial_ids int[] readonly Zero or more BIP identifiers of trait Plant Trials performed for this population until the present date
plant_line_ids int[] readonly Zero or more BIP identifiers of Plant Lines that this population is associated with
plant_population_list_ids int[] readonly Zero or more BIP identifiers of Plant Population Lists, which serve as a join table between Plant Lines and Plant Populations
published_on datetime readonly The day and time the data was published
GET /api/v1/plant_populations

Example

GET /api/v1/plant_populations?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/plant_populations/:id

Example

GET /api/v1/plant_populations/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/plant_populations

Example

POST /api/v1/plant_populations HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "plant_population": {
    "name": "My new population"
  }
}

PlantPopulationList

The following table shows a list of attributes describing this resource:
Attributes
sort_order string -
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_provenance string Additional information regarding the origin of this data
confirmed_by_whom string The person who accepted this BIP database entry
plant_population_id int required BIP identifier of the Plant Population related to this list
plant_line_id int required BIP identifier of the Plant Line related to this list
published_on datetime readonly The day and time the data was published
GET /api/v1/plant_population_lists

Example

GET /api/v1/plant_population_lists?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/plant_population_lists/:id

Example

GET /api/v1/plant_population_lists/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/plant_population_lists

Example

POST /api/v1/plant_population_lists HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "plant_population_list": {
    "plant_population_id": 5,
    "plant_line_id": 78
  }
}

PlantScoringUnit

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
scoring_unit_name string required, Q Unique name assigned to this scoring unit by the person who submitted the data
number_units_scored string Q Number of units scored for this particual scoring scenario
scoring_unit_sample_size string Q The size of the scored unit
scoring_unit_frame_size string Q The size of the scored unit
date_planted date Q Day on which the population scored in this unit was planted
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_owned_by string Name of the legal entity which published this data
data_provenance string Additional information regarding the origin of this data
confirmed_by_whom string The person who accepted this BIP database entry
design_factor_id int BIP identifier of the Design Factor object, which stores additional information concerning the design of this experiment
plant_accession_id int required BIP identifier of the associated database Plant Accession
plant_trial_id int required BIP identifier of the Plant Trial in the scope of which this plant scoring took place
trait_score_ids int[] readonly Zero or more BIP identifiers of Trait Scores recorded in this scoring unit
published_on datetime readonly The day and time the data was published
GET /api/v1/plant_scoring_units

Example

GET /api/v1/plant_scoring_units?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/plant_scoring_units/:id

Example

GET /api/v1/plant_scoring_units/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/plant_scoring_units

Example

POST /api/v1/plant_scoring_units HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "plant_scoring_unit": {
    "scoring_unit_name": "plant_2/2016",
    "plant_accession_id": 755,
    "plant_trial_id": 1
  }
}

PlantTrial

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
plant_trial_name string required, Q Unique name assigned to this scoring trial by the person who submitted the data
project_descriptor string required, Q Name of the project that undertook the trial
plant_trial_description string required, Q Additional descriptive information concerning the trial
trial_year string required, Q Year (or years) the trial took place
institute_id string required, Q Name of the legal entity that performed this plant trial
trial_location_site_name string Q Site where the plant trial was performed
place_name string required Place where the plant trial was performed
country object Country where the plant trial took place
latitude string Geographical latitude of the exact location where this trial took place
longitude string Geographical longitude of the exact location where this trial took place
altitude string Altitude of the exact location where this trial took place
terrain string Description of the environment of the cultivation process (e.g. what type of glasshouse was used)
soil_type string Type of soil was used in the cultivation process
contact_person string Contact information for this trial
design_type string How the cultivation and the trial were designed
statistical_factors string Factors which influenced statistical analysis of the trial's outcome
design_factors string Additional information about the design factors involved in the plant trial
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_owned_by string Name of the legal entity which published this data
data_provenance string Additional information regarding the origin of this data
confirmed_by_whom string The person who accepted this BIP database entry
pubmed_id string PubMed identifier of the publication where this plant trial was published
plant_population_id int BIP identifier of the plant population that was the subject of this trial
country_id int BIP identifier of the country where this trial took place
plant_scoring_unit_ids int[] readonly Zero or more BIP identifiers of Plant Scoring Units recorded during this trial
published_on datetime readonly The day and time the data was published
GET /api/v1/plant_trials

Example

GET /api/v1/plant_trials?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/plant_trials/:id

Example

GET /api/v1/plant_trials/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/plant_trials

Example

POST /api/v1/plant_trials HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "plant_trial": {
    "plant_trial_name": "BIPrassica Trial Spring 2016",
    "project_descriptor": "BIPrassica Project",
    "trial_year": "2016",
    "place_name": "Norwich",
    "country_id": 107
  }
}

PlantVariety

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
plant_variety_name string required, Q The name of this variety provided either by the person submitting the data or the database curator
crop_type string Q Crop type of this variety (e.g. kale, swede, rape etc.)
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_provenance string Additional information regarding the origin of this data
data_attribution string Q Additional information about the data attribution for this variety
year_registered string Q Year (or years) when this variety was officially registered
breeders_variety_code string Q Code assigned to this variety by plant breeders
owner string Q Name of the legal organization which introduced this variety
quoted_parentage string Q Parentage information for this variety as given in literature or provided by the database curator
female_parent string Q Female parent of this variety, if identified
male_parent string Q Male parent of this variety, if identified
countries_of_origin object[] readonly Zero or more JSON documents listing countries that this variety originates from
countries_of_origin_ids int[] writeonly Zero or more BIP identifiers of countries that this variety originates from
countries_registered object[] readonly Zero or more JSON documents listing countries that this variety is registered in
countries_registered_ids int[] writeonly Zero or more BIP identifiers of countries that this variety is registered in
plant_accession_ids int[] readonly Zero or more BIP identifiers of related Plant Accessions
plant_line_ids int[] readonly Zero or more BIP identifiers of Plant Lines classified under this plant variety
published_on datetime readonly The day and time the data was published
GET /api/v1/plant_varieties

Example

GET /api/v1/plant_varieties?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/plant_varieties/:id

Example

GET /api/v1/plant_varieties/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/plant_varieties

Example

POST /api/v1/plant_varieties HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "plant_variety": {
    "plant_variety_name": "BIPrassica"
  }
}

PopulationLocus

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
mapping_locus string required, Q Unique name assigned to this population locus by the person submitting the data
defined_by_whom string Q Name of the person who defined and described this population locus
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_owned_by string Name of the legal entity which published this data
data_provenance string Additional information regarding the origin of this data
plant_population_id int BIP identifier of the plant population for which the locus was identified
marker_assay_id int BIP identifier of the marker assay associated with this locus
map_position_ids int[] readonly Zero or more BIP identifiers of map positions associated with this locus
map_locus_hit_ids int[] readonly Zero or more BIP identifiers of Map Locus Hits associated with this locus
published_on datetime readonly The day and time the data was published
GET /api/v1/population_loci

Example

GET /api/v1/population_loci?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/population_loci/:id

Example

GET /api/v1/population_loci/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/population_loci

Example

POST /api/v1/population_loci HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "population_locus": {
    "mapping_locus": "A07.790"
  }
}

PopulationType

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
population_type string Textual description of the population type
population_class string Class of populations this type belongs to
assigned_by_whom string Assignee of this population type
plant_population_ids int[] Zero or more BIP identifiers of Plant Populations that are of this population type
GET /api/v1/population_types

Example

GET /api/v1/population_types?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/population_types/:id

Example

GET /api/v1/population_types/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!

Primer

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
primer string required, Q Unique name that identifies this primer
sequence string required, Q Exact sequence of the primer
sequence_id string Q Identifier of the primer sequence, in a source database
sequence_source_acronym string Q Name of the source database where the probe sequence can be obtained
description string Q Additional description of the primer provided by the person who submitted the data
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_owned_by string Name of the legal entity which published this data
data_provenance string Additional information regarding the origin of this data
marker_assays_a_ids int[] readonly Zero or more BIP identifiers of marker assays related to that primer (5` end)
marker_assays_b_ids int[] readonly Zero or more BIP identifiers of marker assays related to that primer (3` end)
published_on datetime readonly The day and time the data was published
GET /api/v1/primers

Example

GET /api/v1/primers?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/primers/:id

Example

GET /api/v1/primers/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/primers

Example

POST /api/v1/primers HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "primer": {
    "primer": "pr3_ENA3",
    "sequence": "GTCAAGTTTCTCTCCACACC"
  }
}

Probe

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
probe_name string required, Q Unique name that identifies this probe
clone_name string required, Q Clone type (e.g. genomic survey sequence GSS, expressed sequence tag EST, or similar)
sequence_id string required, Q Identifier of the probe sequence
sequence_source_acronym string required, Q Name of the source database where the probe sequence can be obtained
date_described date Q Day on which this probe was described
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
data_provenance string Additional information regarding the origin of this data
taxonomy_term_id int BIP identifier of the Taxonomy Term this probe is related to
marker_assay_ids int[] readonly Zero or more BIP identifiers of marker assays related to this probe
published_on datetime readonly The day and time the data was published
GET /api/v1/probes

Example

GET /api/v1/probes?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/probes/:id

Example

GET /api/v1/probes/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/probes

Example

POST /api/v1/probes HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "probe": {
    "probe_name": "pR60",
    "clone_name": "pR60",
    "sequence_id": "70814396",
    "sequence_source_acronym": "NCBI_GSS"
  }
}

Qtl

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
qtl_rank string required, Q Order of QTL on an associated linkage group
map_qtl_label string required, Q Label assigned to this QTL
outer_interval_start string Q Start location of the mapped outer QTL interval (interpretation depends on the used interval mapping method)
outer_interval_end string Q End location of the mapped outer QTL interval (interpretation depends on the used interval mapping method)
inner_interval_start string Q Start location of the mapped inner QTL interval (interpretation depends on the used interval mapping method)
inner_interval_end string Q End location of the mapped inner QTL interval (interpretation depends on the used interval mapping method)
qtl_mid_position string required, Q Position used for mapping this QTL
peak_value string Q Peak probability value for the QTL intervals represented by this record (QTL curve peak value)
peak_p_value string Q -
regression_p string Q -
residual_p string Q -
additive_effect string Q -
genetic_variance_explained string Q -
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_owned_by string Name of the legal entity which published this data
data_provenance string Additional information regarding the origin of this data
pubmed_id string PubMed identifier of the publication where this QTL was published
qtl_job_id int BIP identifier of the QTL Job that describes the method used to obtain this QTL
linkage_group_id int BIP identifier of the Linkage Group that this QTL is associated with
published_on datetime readonly The day and time the data was published
GET /api/v1/qtls

Example

GET /api/v1/qtls?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/qtls/:id

Example

GET /api/v1/qtls/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/qtls

Example

POST /api/v1/qtls HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "qtl": {
    "qtl_rank": "7",
    "map_qtl_label": "Mg-f-mr",
    "qtl_mid_position": "52.96"
  }
}

QtlJob

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
qtl_job_name string required, Q Name assigned to this QTL job by the database curator
qtl_software string required, Q Software used to obtain the associated QTLs in this QTL job
qtl_method string required, Q Algorithm used to map QTL intervals
threshold_specification_method string Q How the likelihood score threshold was specified for interval mapping
interval_type string Q Type of interval(s) measured in this QTL job
inner_confidence_threshold string Q Confidence level for the QTL inner interval
outer_confidence_threshold string Q Confidence level for the QTL outer interval
qtl_statistic_type string Q Statistical method used for computing QTL interval boundaries
described_by_whom string Person who executed this QTL job
date_run date Q Day on which the QTL job was executed
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_owned_by string Name of the legal entity which published this data
data_provenance string Additional information regarding the origin of this data
linkage_map_id int BIP identifier of the Linkage Map computed using this algorithm execution
qtl_ids int[] readonly Zero or more BIP identifiers of QTLs that were defined as a result of this QTL job execution
published_on datetime readonly The day and time the data was published
GET /api/v1/qtl_jobs

Example

GET /api/v1/qtl_jobs?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/qtl_jobs/:id

Example

GET /api/v1/qtl_jobs/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/qtl_jobs

Example

POST /api/v1/qtl_jobs HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "qtl_job": {
    "qtl_job_name": "My first QTL run",
    "qtl_software": "QTL Cafe",
    "qtl_method": "Marker regression"
  }
}

TaxonomyTerm

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
label string Gramene Taxonomy ontology identifier, if available
name string Regular taxonomical name
taxonomy_term_id int BIP identifier of the parent Taxonomy Term (not present for root terms)
canonical boolean Set to true if the term is defined in Gramene Taxonomy; false otherwise
plant_line_ids int[] Zero or more BIP identifiers of Plant Lines classified under this term
plant_population_ids int[] Zero or more BIP identifiers of Plant Populations classified under this term
probe_ids int[] Zero or more BIP identifiers of Probes classified under this term
GET /api/v1/taxonomy_terms

Example

GET /api/v1/taxonomy_terms?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/taxonomy_terms/:id

Example

GET /api/v1/taxonomy_terms/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!

Trait

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
name string Short textual definition of the trait
label string Trait Ontology term id, if available
description string Longer description of the trait, usually supplied by the ontology maintainers
canonical string Whether this trait is defined in Trait Ontology or not
data_provenance string Additional information regarding the origin of this data
trait_descriptor_ids int[] Zero or more BIP identifiers of Trait Descriptors related to this trait
GET /api/v1/traits

Example

GET /api/v1/traits?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/traits/:id

Example

GET /api/v1/traits/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!

TraitDescriptor

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
descriptor_label string Q Unique label assigned to this descriptor by the database curator
category string Plant trait category described by this descriptor
units_of_measurements string required, Q How the trait is measured
trait_grades object[] Optional descriptive grades which can be applied to score this trait
where_to_score string Where the trait is measured
scoring_method string required, Q Method used to obtain the trait measure
when_to_score string When in the cultivation process the trait is measured
stage_scored string At what stage of plant growth the trait is scored
precautions string Special conditions taken into account when scoring the trait
materials string Q Materials required for proper scoring
instrumentation_required string Instruments required for proper scoring
controls string Control group (data) used in the scoring experiment
calibrated_against string How the instruments should be calibrated for the scoring experiment
likely_ambiguities string Ambiguities that may influence the trait measures taken
possible_interactions string Environmental interactions that should be taken into account when scoring
score_type string Nature of the final score (direct or otherwise, computation methods applied, etc.)
contact_person string Person to be contacted regarding further information about scoring this trait
authorities string Institutions or individuals who should be referred to regarding the method of scoring this trait
date_method_agreed date Day on which this scoring method was published
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_owned_by string Name of the legal entity which published this data
data_provenance string Additional information regarding the origin of this data
confirmed_by_whom string The person who accepted this BIP database entry
plant_part_id int BIP identifier of the plant part record that describes what part of plant was used for scoring this trait
trait_id int required BIP identifier of the record in the Trait vocabulary that defines the scored trait
trait object readonly Entry in BIP traits vocabulary this Trait Descriptor refers to; describes the scored trait in detail
trait_score_ids int[] readonly Zero or more BIP identifiers of Trait Scores measured for this plant trait in various projects
published_on datetime readonly The day and time the data was published
GET /api/v1/trait_descriptors

Example

GET /api/v1/trait_descriptors?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/trait_descriptors/:id

Example

GET /api/v1/trait_descriptors/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/trait_descriptors

Example

POST /api/v1/trait_descriptors HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "trait_descriptor": {
    "units_of_measurements": "percent total seed fatty acid (%)",
    "category": "seed composition",
    "scoring_method": "Gas Chromatography",
    "trait_id": 1353
  }
}

TraitScore

The following table shows a list of attributes describing this resource:
Attributes
id int readonly, Q Unique BIP database identifier
score_value string required Value measured and recorded in the trial
value_type string Meaning of the score value
technical_replicate_number string Ordinal number of the technical replicate for which this score was measured
scoring_date date Day on which the scoring was performed
comments string Additional note from the person who published this data
entered_by_whom string The name of the person who published this data
date_entered date The day the data was published
data_owned_by string Name of the legal entity which published this data
data_provenance string Additional information regarding the origin of this data
confirmed_by_whom string The person who accepted this BIP database entry
plant_scoring_unit_id int required BIP identifier of the Plant Scoring Unit that contains this trait score
trait_descriptor_id int required BIP identifier of the Trait Descriptor that provides more information about the scored trait
published_on datetime readonly The day and time the data was published
GET /api/v1/trait_scores

Example

GET /api/v1/trait_scores?per_page=3 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
GET /api/v1/trait_scores/:id

Example

GET /api/v1/trait_scores/1 HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836
Sign in to try it in your browser!
POST /api/v1/trait_scores

Example

POST /api/v1/trait_scores HTTP/1.1
Content-Type: application/json
Accept: application/json
X-BIP-Api-Key: ba6d4625927ede0db8768782994d9276cfff9ba79e8df8c831aedc453e850836

{
  "trait_score": {
    "score_value": "1000",
    "plant_scoring_unit_id": 56456,
    "trait_descriptor_id": 2
  }
}

CropStoreDB acknowledgement

As the BIP database Schema is based on the CropStoreDB schema, the definitions in the API documentation are heavily derived from those in CropStoreDB. We would like to acknowledge the CropStoreDB team managed by Graham King for the prior work this webpage draws from. Their database can be found on CropStoreDB and their resource is cited as Love et al. (2012).

Love, C. G., Andongabo, A. E., Wang, J., Carion, P. W. C., Rawlings, C. J. and King, G. J. (2012), InterStoreDB: A Generic Integration Resource for Genetic and Genomic Data. Journal of Integrative Plant Biology, 54: 345–355. doi: 10.1111/j.1744-7909.2012.01120.x